README for Chlamydomonas reinhardtii Version4 First Improved release 11-02-2007 Files available in this release are: 1. C_reinhardtii.README: Contains details about this release 2. C_reinhardtii.AGP: Gives the relationship between the scaffolds in the chromosome layout. The start and stop points of each scaffold within a chromosome are given along with direction (where known). This file was used to convert [6] into [3]. 3. C_reinhardtii.main_genome.scaffolds.fasta: The main genome release containing all mapped and unmapped sequence. 4. C_reinhardtii.main_genome.scaffolds.qual: Quality scores of each base in [3] 5. C_reinhardtii.layout: Gives a list of all scaffolds either mapped to a chromosome or unmapped. plus the direction (c=complemented; u=uncomplemented;k=unordered) 6. C_reinhardtii.main_genome.unmapped.scaffolds.fasta: Contains all the sequence from [3] as individual, unordered scaffolds. 7. C_reinhardtii.main_genome.unmapped.scaffolds.qual. Quality scores of each base in [6]. The scaffolds were mapped using 349 markers (duplicates and markers without sequence information were not included) from the Rymarquis 2005 paper. Stats on 11-02-2007 Version4 Mapped release [3] above: Main genome chromosome/scaffold total: 88 Main genome contig total: 2739 Main genome scaffold sequence total: 112.3 MB Main genome contig sequence total: 103.8 MB (-> 7.5% gap) Main genome scaffold N/L50: 7/6.6 MB Main genome contig N/L50: 322/90.6 KB Number of scaffolds > 50 KB: 55 % main genome in scaffolds > 50 KB: 99.2% Stats on 11-02-2007 Version4 pre-mapped release [6] above: Main genome scaffold total: 132 Main genome contig total: 2739 Main genome scaffold sequence total: 111.9 MB Main genome contig sequence total: 103.8 MB (-> 7.2% gap) Main genome scaffold N/L50: 16/2.6 MB Main genome contig N/L50: 322/90.6 KB Number of scaffolds > 50 KB: 96 % main genome in scaffolds > 50 KB: 99.1% Stats on 03-23-2005 Version3 release: Main genome scaffold total: 1557 Main genome contig total: 11383 Main genome scaffold sequence total: 120.2 MB Main genome contig sequence total: 105.2 MB (-> 12.5% gap) Main genome scaffold N/L50: 24/1.7 MB Main genome contig N/L50: 603/44.6 KB Number of scaffolds > 50 KB: 123 % main genome in scaffolds > 50 KB: 91.6% >telomere.signature TAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTGGAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCC TAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCC TAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCTAAAAACCCTAAAACCCTAAAACCC TAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCC TAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCCTAAAACCC Chromosomes are named 1-17 and ordered based on LGs. Eg chromosome_1 = LG1, chromosome_12 = LG1213, chromosome_17 = LG19. Sequence within a chromosome is ordered and unordered based on available markers (see below). Gaps are represented by Ns. Gaps between contigs are estimated based on a given library size. Uncaptured gaps (scaffold gaps) have randomly sized at 10,000bp (represented by 10,000 Ns). Unmapped sequences are named scaffold_X. Chr Size # scaffolds Scaffolds ordered? Telomeres 1 9,982,135 4 Y/Y/Y/Y ----* 2 9,975,745 4 Y/Y/Y/Y *---- 3 7,773,334 4 Y/Y/Y/N ---- 4 3,005,669 3 N/N/Y ---- 5 3,366,352 5 N/N/N/N/Y ---- 6 7,695,193 4 Y/Y/Y/Y ----* 7 6,170,768 4 Y/Y/Y/Y ---- 8 4,189,090 4 N/N/Y/N ---- 9 4,733,070 3 Y/Y/Y ----* 10 6,579,462 2 Y/Y ----* 11 2,734,619 4 Y/Y/Y/Y ----* 12 9,355,449 5 Y/Y/Y/Y/Y *---- 13 6,588,689 2 Y/Y *----* 14 4,114,342 1 Y ---- 15 3,066,274 5 Y/Y/N/N/N *---- 16 6,617,689 5 Y/Y/N/N/Y ----* 17 6,673,064 2 Y/Y *---- TOTAL 102,620,943bp 61 12 Scaffolds 18 1,287,285 ----* 19 814,470 20 598,575 *---- 21 558,747 22 430,403 23 373,397 24 339,605 25 333,029 26 317,769 27 256,895 28 253,209 29 245,379 *---- 30 238,238 31 222,931 32 217,100 *---- 33 214,180 34 186,456 35 179,663 36 154,127 37 123,055 38 120,767 ----* 39 119,177 40 116,725 41 99,905 42 98,780 43 80,533 44 80,252 45 79,195 46 72,145 47 67,355 48 66,577 49 65,629 50 63,401 51 63,266 52 59,018 53 55,340 54 54,374 55 50,490 56 47,028 57 46,469 58 45,221 *---- 59 43,590 60 43,313 61 39,687 62 38,880 63 36,644 64 36,299 65 36,037 66 32,450 67 30,996 68 29,908 69 29,423 70 28,937 71 28,038 72 26,265 73 25,979 74 25,574 75 25,288 76 23,213 77 22,385 78 21,742 79 21,191 80 20,468 81 20,314 82 20,067 83 18,413 84 15,458 85 13,564 86 12,875 87 1,2675 88 8,671 TOTAL 9,684,504 71 ALL 112,305,447bp 132 18